View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_97 (Length: 214)
Name: NF6277_low_97
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 37223908 - 37223734
Alignment:
| Q |
20 |
attgcgccatccttggacactgtggttgaaccagcttccgagctactggacaatgaaagtaatcctgcagcatatgttgggatgaaacatatagattata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223908 |
attgcgccatccttggacactgtggttgaaccagcttccgagctactagacaatgaaagtaatcctgcagcatatgttgggatgaaacatatagattata |
37223809 |
T |
|
| Q |
120 |
tgaaacttcaacgaaacaaccagctttacgggaaatctgtgctaaacaaagtgaaaatatgattttgaatcacct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223808 |
tgaaacttcaacgaaacaaccagctttacgggaaatctgtgctaaacaaagtgaaaatatgattttgaatcacct |
37223734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University