View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_98 (Length: 202)
Name: NF6277_low_98
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 183
Target Start/End: Original strand, 7735099 - 7735268
Alignment:
| Q |
14 |
cataggaagcaaaagctgacctctcattgttatctgatggaaagaagtataacgctatatcttgaagactgggagaataattctggaattcatcagtcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7735099 |
cataggaagcaaaagctgacctctcattgttatctgatggaaagaagtataacgctatatcttgaagactgggagaataattctggaattcatcagtcaa |
7735198 |
T |
|
| Q |
114 |
gacattcaaagcaggaagtgattccagttgaaggactgagggaattttgcttgaaagattgtatgccttc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7735199 |
gacattcaaagcaggaagtgattccagttgaaggactgagggaattttgcttgaaagattgtatgccttc |
7735268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University