View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6278_high_2 (Length: 438)
Name: NF6278_high_2
Description: NF6278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6278_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 19 - 428
Target Start/End: Complemental strand, 50047942 - 50047533
Alignment:
| Q |
19 |
taagtaataaattaaagcttctctaaggactaagatagatccaaataagatataaccatcaaattgtctaatttaggttcttaattttgagcttcacttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047942 |
taagtaataaattaaagcttctctaaggactaagatagatccaaataagatataaccatcaaattgtctaatttaggttcttaattttgagcttcacttt |
50047843 |
T |
|
| Q |
119 |
tgttggtttatcataggttacgctatttgcagtgcacttcacaggctgcgtgtatttttggttggctttccatcacaaatcacccggaaacacgtggatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047842 |
tgttggtttatcataggttacgctatttgcagtgcacttcacaggctgcgtgtatttttggttggctttccatcacaaatcacccggaaacacgtggatt |
50047743 |
T |
|
| Q |
219 |
gggaagcaggtagaggattttaagcataggagtgtcggatcgggttacacttactccatgtattggtctattgtaacccttaccactgttggctatggag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047742 |
gggaagcaggtagaggattttaagcataggagtgtcggatcgggttacacttactccatgtattggtctattgtaacccttaccactgttggctatggag |
50047643 |
T |
|
| Q |
319 |
atttacatgcagaaaatacaacggagaaggttttcaatattttttatatgctgtttaacatcggactcactgcatatattatcggaaacatgacaaatct |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50047642 |
atttacatgcagaaaatacaacggagaaggttttcaatattttttatatgctgtttaacatcggactcactgcatatattatcggaaacatgacaaatct |
50047543 |
T |
|
| Q |
419 |
ggtggttcat |
428 |
Q |
| |
|
|||||||||| |
|
|
| T |
50047542 |
ggtggttcat |
50047533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University