View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6278_high_7 (Length: 262)
Name: NF6278_high_7
Description: NF6278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6278_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 9 - 246
Target Start/End: Original strand, 836460 - 836705
Alignment:
| Q |
9 |
gacatcatcagtgtaacaaatctagaggctcggttattccagacaattgaatata--attatatctgtacgtttatgtatttcacaatttaat------g |
100 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| | |
|
|
| T |
836460 |
gacatcatcaatgtaacaaatctaaaggctcggatattccagacaattgaatatagttttatatttgtacgtttatgtatttcacaatttaatgatatcg |
836559 |
T |
|
| Q |
101 |
atatcatcatcaacaatgt-agcgtgtgttatatcaatgtactttaccaatttgaataaacaaatattgtttattagannnnnnnnnaataaagttgcta |
199 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
836560 |
atatcatcatcgacaatgtgagcgtgtgttatatcaatgtactttaccaatttgaataaacaaatattgtttattaga-ttttttttaataaagttgcta |
836658 |
T |
|
| Q |
200 |
tattagcccctaacaaggaattgcttaatgaacagagtagagttgtt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
836659 |
tattagcccctaacaaggaattgcttaatgaacagagtagaggtgtt |
836705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 173
Target Start/End: Complemental strand, 38379462 - 38379420
Alignment:
| Q |
131 |
tatcaatgtactttaccaatttgaataaacaaatattgtttat |
173 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
38379462 |
tatcaatgtactttatcaatttgaataaataaatatcgtttat |
38379420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University