View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6278_low_6 (Length: 320)
Name: NF6278_low_6
Description: NF6278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6278_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 110 - 303
Target Start/End: Original strand, 2237141 - 2237334
Alignment:
| Q |
110 |
gtatattaccgtaaaccatagaagagttccattgtcgcgatccaatgcccaagcaaatccacttttctgaacagcaacaacaatgtctttctcagtacca |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||| |
|
|
| T |
2237141 |
gtatattaccgtaaaccatagaagggttccattgtcgcgatccaatgcccaagcaaatccacttttctgaacagcaacaacaatatctttctttgttcca |
2237240 |
T |
|
| Q |
210 |
tttacatgtgtagttaacatcattggtgcctctccaaaatctgcatctggtataggaccttgaggcggacaattaggaagtgaagcatttttac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| || ||||||||| |||| |
|
|
| T |
2237241 |
tttacatgtgtagttaacatcattggtgcctctccaaaatctgcatctggtatagaaccttgaggtggacaattagaaattgaagcattgttac |
2237334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 256
Target Start/End: Complemental strand, 2261321 - 2261221
Alignment:
| Q |
156 |
gcccaagcaaatccacttttctgaacagcaacaacaatgtctttctcagtaccatttacatgtgtagttaacatcattggtgcctctccaaaatctgcat |
255 |
Q |
| |
|
|||||||| || ||||| || || |||||||||||||| |||| | ||||||||| |||| | || | |||||||||||||||||||||||| |||| |
|
|
| T |
2261321 |
gcccaagcgaaaccactcttttgtacagcaacaacaatatcttgtttagtaccattaacatcaattgtgagcatcattggtgcctctccaaaatcagcat |
2261222 |
T |
|
| Q |
256 |
c |
256 |
Q |
| |
|
| |
|
|
| T |
2261221 |
c |
2261221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University