View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6280_high_5 (Length: 261)
Name: NF6280_high_5
Description: NF6280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6280_high_5 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 123 - 261
Target Start/End: Original strand, 6723784 - 6723922
Alignment:
| Q |
123 |
acaatattatcataaaacatttgtttcctataccataatcaagttaattgaataatccataaaatttgtacccnnnnnnnnnnnntaaataatacataaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
6723784 |
acaatattatcataaaacatttgtttcctataccataatcaagttaattgaataatccataaaatttgtacccaaaaaaaaaaaaagaataatccataaa |
6723883 |
T |
 |
| Q |
223 |
atatttaatgaatgtagcagagatgaatgggttggcttc |
261 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6723884 |
atatttaatgaatgtggcagagatgaatgggttggcttc |
6723922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University