View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6280_low_3 (Length: 445)
Name: NF6280_low_3
Description: NF6280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6280_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 11 - 429
Target Start/End: Complemental strand, 44056152 - 44055734
Alignment:
| Q |
11 |
cacagatataggaaagcttgctctttcggctgcactcatcagtgatgtgtgtgcttggattctcttggctttagccattgcaatggctgagaaccaagca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44056152 |
cacagatataggaaagcttgctctttcggctgcactcatcagtgatgtgtgtgcttggattctcttggctttagccattgcaatggctgagaaccaagca |
44056053 |
T |
 |
| Q |
111 |
acttctttcgcttccctttgggttctattgtctgccgcagcgtttgtcgccatttgtatttacgctgttagacccgcagcttcatggatagttcggaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44056052 |
acttctttcgcttccctttgggttctattgtctgccgcagcgtttgtcgccatttgtatttacgctgttagacccgcagcttcatggatagttcagaaaa |
44055953 |
T |
 |
| Q |
211 |
cacctgagggtgaatctttcagtgagttttatatatctcttatattagccggagtcatggtctccggtttcatcactgatgctattggaactcattctgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44055952 |
cacctgagggtgaatctttcagtgagttttatatatctcttatattagccggagtcatggtctccggtttcatcactgatgctattggaactcattctgt |
44055853 |
T |
 |
| Q |
311 |
tttcggagcttttgtgttcggtttggcaattccgaatggaccgcttggtgtttctctggtagaaaagcttgaggattttgtttcaggacttttgttacct |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44055852 |
tttcggagcttttgtgttcggtttggcaattccgaatggaccgcttggtgtttctctggtagaaaagcttgaggattttgtttcaggacttttgttacct |
44055753 |
T |
 |
| Q |
411 |
ctcttttttgccattagtg |
429 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44055752 |
ctcttttttgccattagtg |
44055734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 4e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 276 - 429
Target Start/End: Complemental strand, 39237759 - 39237606
Alignment:
| Q |
276 |
ggtttcatcactgatgctattggaactcattctgttttcggagcttttgtgttcggtttggcaattccgaatggaccgcttggtgtttctctggtagaaa |
375 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||| ||||| | |||||| |||||| || |||| | |||| |
|
|
| T |
39237759 |
ggtttcatcacagatgctattggaactcattctgtttttggagcttttgtgtttggtttgattattccaactggaccacttggttttgctcttattgaaa |
39237660 |
T |
 |
| Q |
376 |
agcttgaggattttgtttcaggacttttgttacctctcttttttgccattagtg |
429 |
Q |
| |
|
|||||||||| |||||||| ||||||||| | |||||||||||||| ||||||| |
|
|
| T |
39237659 |
agcttgaggactttgtttctggacttttgcttcctctcttttttgcaattagtg |
39237606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University