View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6280_low_6 (Length: 310)
Name: NF6280_low_6
Description: NF6280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6280_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 2332478 - 2332181
Alignment:
| Q |
1 |
aaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagttacaggcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2332478 |
aaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagtgacaggcaa |
2332379 |
T |
|
| Q |
101 |
gagaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattggaatagattcat |
200 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
2332378 |
gagaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattgggatagatgcat |
2332279 |
T |
|
| Q |
201 |
aaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtcttctgatgatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2332278 |
aaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaaccagaaattttatttcgccgtcttctgatgatg |
2332181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University