View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6280_low_9 (Length: 202)
Name: NF6280_low_9
Description: NF6280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6280_low_9 |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 85 - 177
Target Start/End: Complemental strand, 13514987 - 13514895
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13514987 |
aggcttaatacatcctttggtcccttaacttaattctttttctcagtatggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
13514895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 85 - 177
Target Start/End: Complemental strand, 13604520 - 13604428
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13604520 |
aggcttaatacatcctttggtcccttaacttaattctttttctcagtatggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
13604428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 85 - 177
Target Start/End: Original strand, 13513414 - 13513506
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||| |||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13513414 |
aggcttaatacatcctttggtcccttaacttaattctttttctcaatatggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
13513506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 85 - 177
Target Start/End: Original strand, 13602947 - 13603039
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||| |||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13602947 |
aggcttaatacatcctttggtcccttaacttaattctttttctcaatatggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
13603039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 85 - 177
Target Start/End: Original strand, 21670058 - 21670150
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21670058 |
aggcttaatacatccgttggtcccttaacttaattctttttctcagtatggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
21670150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 138 - 177
Target Start/End: Complemental strand, 44103365 - 44103326
Alignment:
| Q |
138 |
ccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44103365 |
ccctaactaaaaaacgtctcaaattggtctcttatgtctt |
44103326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 139 - 177
Target Start/End: Original strand, 39323835 - 39323873
Alignment:
| Q |
139 |
cctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39323835 |
cctaactaaaaaacgtctcaaattgatctcttatgtctt |
39323873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 38665923 - 38665878
Alignment:
| Q |
146 |
aaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38665923 |
aaaaaacgtttcaaactggtctcttatctcttttgtcgttatctct |
38665878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 177
Target Start/End: Original strand, 44101942 - 44102035
Alignment:
| Q |
85 |
aggcttaatacatcctatagtcccttaacttaannnnnnnnatcagtatggttccctaactaaaa-aacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||| |||| ||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44101942 |
aggcttaatatatcatttagtcccttaacttaattctttttttcagaatggtgtcctaactaaaaaaacgtctcaaattggtctcttatgtctt |
44102035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 174
Target Start/End: Original strand, 13360400 - 13360436
Alignment:
| Q |
138 |
ccctaactaaaaaacgtctcaaattggtctcttatgt |
174 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
13360400 |
ccctaattaaaaaacgtctcaaattggtcccttatgt |
13360436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 21961871 - 21961923
Alignment:
| Q |
139 |
cctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||| | |||||||||| |
|
|
| T |
21961871 |
cctaattaaaaaacgtctcaaattgatcccttatgtcttcttccgttatctct |
21961923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 15)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 127 - 191
Target Start/End: Complemental strand, 18358453 - 18358389
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18358453 |
tcagtatggtcccctaactaaaaaacgtcttaaattggtcccttatgtcttttgtcgttacctct |
18358389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 36604476 - 36604540
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
36604476 |
tcagtatggtcccctaactaaaaaacgtcttaaattggtcccttatgtcttttgtcgttacctct |
36604540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 38371874 - 38371826
Alignment:
| Q |
138 |
ccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgtta |
186 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
38371874 |
ccctaactaaaaaacgtctcaaattgatcccttatgtcttttgtcgtta |
38371826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 36604921 - 36604871
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
36604921 |
tcagtatggtcccctaactaaaaaacgtcttaaattggtcccttatgtctt |
36604871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 177
Target Start/End: Original strand, 2292191 - 2292236
Alignment:
| Q |
132 |
atggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2292191 |
atggtcccctaactaaaaaacgcctcaaattggtcccttatgtctt |
2292236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 2293600 - 2293555
Alignment:
| Q |
132 |
atggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2293600 |
atggtcccctaactaaaaaacgtcttaaattggtcccttatgtctt |
2293555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 1420579 - 1420544
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1420579 |
atcgcaactttggaaaagttagggggctaaaactgc |
1420544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2016835 - 2016800
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2016835 |
atcgcaactttggaaaagttagggggctaaaactgc |
2016800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 21957737 - 21957772
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21957737 |
atcgcaactttggaaaagttagggggctaaaactgc |
21957772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Complemental strand, 96755 - 96701
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttat |
187 |
Q |
| |
|
|||| ||||||||| ||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
96755 |
tggtcccctaactataaagtgtcttaaattggtcccttatgtcttttgtcgttat |
96701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 2310856 - 2310798
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| |||| ||||||| |||||| ||||||||||||| ||||| |||| |
|
|
| T |
2310856 |
tggtcccctaactataaaatgtctcaatttggtcccttatgtcttttgccgttacctct |
2310798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 53150452 - 53150502
Alignment:
| Q |
141 |
taactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||| ||||||||| |||||||| |
|
|
| T |
53150452 |
taactaaaaaacgtcttaaactggtcccttatatcttttgtcattatctct |
53150502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 14449555 - 14449588
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaact |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
14449555 |
atcgcaactttggaaaagttagggggctaaaact |
14449588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 53151634 - 53151589
Alignment:
| Q |
146 |
aaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
53151634 |
aaaaaacgtcttaaattggtcccttatctcttttgtcgttacctct |
53151589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 189
Target Start/End: Original strand, 15445498 - 15445534
Alignment:
| Q |
153 |
gtctcaaattggtctcttatgtcttttgtcgttatct |
189 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
15445498 |
gtctcaatttggtctcttatgtcttttgccgttatct |
15445534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 7483146 - 7483209
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7483146 |
tcagtatggtccccta-ctaaaaaacgtctcaaattggtctcttatgtcttttgtcgttacctct |
7483209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 7483605 - 7483555
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
7483605 |
tcagtatggtcccctaactaaaaaacgtcttaaattggtcccttatgtctt |
7483555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 5416240 - 5416298
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| |||| ||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
5416240 |
tggtcccctaactataaaatgtctcaatttggtcccttatgtcttttgtcgttacctct |
5416298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 39288513 - 39288455
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
39288513 |
tggtcccctaactataaagtgtctcaatttggtcccttatgtcttatgtcgttatctct |
39288455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 55443624 - 55443566
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
55443624 |
tggtcccctaactataaagtgtctcaatttggtcccttatgtcttttgtcgttacctct |
55443566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 37982727 - 37982777
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37982727 |
tcagtatggttccctaactaaaaaacgtctcaaattggtcccttatgtctt |
37982777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 4513823 - 4513769
Alignment:
| Q |
137 |
tccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |||||||| |||| |
|
|
| T |
4513823 |
tccctaactaaaaaacgtcttaaattggtcttttatgtcttctgtcgttacctct |
4513769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 191
Target Start/End: Complemental strand, 41296529 - 41296470
Alignment:
| Q |
132 |
atggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||| || |||||||||||||| |||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
41296529 |
atggtcccttaactaaaaaacgtttcaatttggtcccttatgttttttgtcgttatctct |
41296470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 177
Target Start/End: Original strand, 26205050 - 26205099
Alignment:
| Q |
128 |
cagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26205050 |
cagtatgatcccttaactaaaaaacgtctcaaattggtcccttatgtctt |
26205099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 8537062 - 8537110
Alignment:
| Q |
141 |
taactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatct |
189 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
8537062 |
taactaaaaaatgtctcaaattggtcccttatgtattctgtcgttatct |
8537110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 6592768 - 6592733
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6592768 |
atcgcaactttggaaaagttagggggctaaaactgc |
6592733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 34679141 - 34679106
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34679141 |
atcgcaactttggaaaagttagggggctaaaactgc |
34679106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 4630158 - 4630100
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| ||| ||||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
4630158 |
tggtcccctaactataaagtgtctcaatttggtctcttatgtcttttgttgttacctct |
4630100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 3255952 - 3255895
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctc |
190 |
Q |
| |
|
|||| ||||||||| ||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3255952 |
tggtcccctaactataaagtgtttcaatttggtctcttatgtcttttgccgttatctc |
3255895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 132 - 177
Target Start/End: Original strand, 4512147 - 4512192
Alignment:
| Q |
132 |
atggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
4512147 |
atggtcccataactaaaaaacgtctcaaattggtcccttgtgtctt |
4512192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 127 - 186
Target Start/End: Original strand, 43111465 - 43111524
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgtta |
186 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
43111465 |
tcagtgtggtcccctaactaaaaaacgtctcaaattgatcacttatgtcttttgtcgtta |
43111524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 127 - 182
Target Start/End: Original strand, 24494021 - 24494076
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtc |
182 |
Q |
| |
|
|||||||| | |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24494021 |
tcagtatgatcccctaactaaaaaatgtctcaaattggtcccttatgtcttttgtc |
24494076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 26407483 - 26407424
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgtta |
186 |
Q |
| |
|
||||| |||| | ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26407483 |
tcagtttggtcctctaactaaaaaacgtctcaaattggtctcttatgttatttgtcgtta |
26407424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 20184960 - 20184926
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
20184960 |
atcgcaactttggaaaagttagggagctaaaactg |
20184926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 41616666 - 41616724
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
41616666 |
tggtcccctaactataaagtgtctcaatttggtcccttatgtcttttgtcgttatctct |
41616724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 6792066 - 6792101
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6792066 |
atcgcaactttggaaaagttagggggctaaaactgc |
6792101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Complemental strand, 24495131 - 24495081
Alignment:
| Q |
127 |
tcagtatggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
|||||||| | || |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24495131 |
tcagtatgatcccttaactaaaaaacctctcaaattggtcccttatgtctt |
24495081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 36903304 - 36903271
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaact |
34 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
36903304 |
atcgcaactttggaaaagtaagggagctaaaact |
36903271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 174
Target Start/End: Original strand, 44113479 - 44113512
Alignment:
| Q |
141 |
taactaaaaaacgtctcaaattggtctcttatgt |
174 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
44113479 |
taactaaaaaacgtctcaaattggtcccttatgt |
44113512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 36
Target Start/End: Complemental strand, 41243685 - 41243653
Alignment:
| Q |
4 |
gcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41243685 |
gcaactttggaaaagttagggggctaaaactgc |
41243653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 51219041 - 51218996
Alignment:
| Q |
132 |
atggttccctaactaaaaaacgtctcaaattggtctcttatgtctt |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51219041 |
atggtcccctaactaaaaaacgtctcaaattggtcccttatgtctt |
51218996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 191
Target Start/End: Original strand, 34531712 - 34531763
Alignment:
| Q |
140 |
ctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
34531712 |
ctaactataaaatgtctcaatttggtctcttatgtcttctgtcgttatctct |
34531763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 179
Target Start/End: Complemental strand, 27690697 - 27690657
Alignment:
| Q |
139 |
cctaactaaaaaacgtctcaaattggtctcttatgtctttt |
179 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
27690697 |
cctaactaaaaaacgtctcaaattggtttcttatgtatttt |
27690657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 27864430 - 27864462
Alignment:
| Q |
4 |
gcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27864430 |
gcaactttggaaaagttagggagctaaaactgc |
27864462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 3377545 - 3377510
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3377545 |
atcgcaactttggaaaagttagggggctaaaactgc |
3377510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 14978841 - 14978806
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaactgc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14978841 |
atcgcaactttggaaaagttagggggctaaaactgc |
14978806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 33850344 - 33850400
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatct |
189 |
Q |
| |
|
|||| |||||||||||||||||||| | ||| || ||||||| || ||||||||||| |
|
|
| T |
33850344 |
tggtcccctaactaaaaaacgtctctatttgatcccttatgtattatgtcgttatct |
33850400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 33943634 - 33943578
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatct |
189 |
Q |
| |
|
|||| |||||||||||||||||||| | ||| || ||||||| || ||||||||||| |
|
|
| T |
33943634 |
tggtcccctaactaaaaaacgtctctatttgatcccttatgtattatgtcgttatct |
33943578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 191
Target Start/End: Complemental strand, 13176402 - 13176349
Alignment:
| Q |
138 |
ccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
13176402 |
ccctaactataaaatgtctcaatttggtcttttatgtcttttgtcgttacctct |
13176349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 28225466 - 28225520
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttat |
187 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
28225466 |
tggtcccctaactataaagtgtctcaatttggtcccttatgtcttttgtcgttat |
28225520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 191
Target Start/End: Complemental strand, 20991718 - 20991665
Alignment:
| Q |
138 |
ccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||||||| |||| ||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
20991718 |
ccctaactataaaatgtctcaatttggtcccttatgtcttttgtcgttacctct |
20991665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 3333971 - 3334004
Alignment:
| Q |
1 |
atcgcaactttggaaaagttagggagctaaaact |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
3333971 |
atcgcaactttggaaaagttagggggctaaaact |
3334004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 2166161 - 2166209
Alignment:
| Q |
141 |
taactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatct |
189 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| || || |||||||| |
|
|
| T |
2166161 |
taactaaaaaacgtctcaaactggtcccttatgtattctgccgttatct |
2166209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 25964 - 26018
Alignment:
| Q |
133 |
tggttccctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttat |
187 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
25964 |
tggtcccctaactataaagtgtctcaatttggtcccttatgtcttttgtcgttat |
26018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 207866 - 207814
Alignment:
| Q |
139 |
cctaactaaaaaacgtctcaaattggtctcttatgtcttttgtcgttatctct |
191 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||||| | |||||||||| |
|
|
| T |
207866 |
cctaattaaaaaacgtctcaaattgatcccttatgtcttcttccgttatctct |
207814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University