View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6281_high_2 (Length: 250)
Name: NF6281_high_2
Description: NF6281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6281_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 105 - 199
Target Start/End: Complemental strand, 42643620 - 42643526
Alignment:
| Q |
105 |
tatctaggcaagcatagttaaggttctacgacatacttatagcgaagaacatgacataccatgagacttctaaatataacattattcctagactt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42643620 |
tatctaggcaagcatagttaaggttctacgacatacttatagcgaagaacatgacataccatgagacttctaaatataacattattcctagactt |
42643526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University