View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6281_low_2 (Length: 300)
Name: NF6281_low_2
Description: NF6281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6281_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 170 - 269
Target Start/End: Original strand, 39781337 - 39781436
Alignment:
| Q |
170 |
gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcacacaggttct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
39781337 |
gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcaaacatgttct |
39781436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 39781193 - 39781266
Alignment:
| Q |
19 |
atttttaacaaaagaaaatttgaaacttagtttggtacttctnnnnnnntttgagtgctaacaaatgtacattg |
92 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39781193 |
atttttaacaaaagaaaatttaaaacttagtttggtacttctaaaaaaacttgagtgctaacaaatgtacattg |
39781266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University