View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6281_low_2 (Length: 300)

Name: NF6281_low_2
Description: NF6281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6281_low_2
NF6281_low_2
[»] chr5 (2 HSPs)
chr5 (170-269)||(39781337-39781436)
chr5 (19-92)||(39781193-39781266)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 170 - 269
Target Start/End: Original strand, 39781337 - 39781436
Alignment:
170 gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcacacaggttct 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||    
39781337 gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcaaacatgttct 39781436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 39781193 - 39781266
Alignment:
19 atttttaacaaaagaaaatttgaaacttagtttggtacttctnnnnnnntttgagtgctaacaaatgtacattg 92  Q
    ||||||||||||||||||||| ||||||||||||||||||||        ||||||||||||||||||||||||    
39781193 atttttaacaaaagaaaatttaaaacttagtttggtacttctaaaaaaacttgagtgctaacaaatgtacattg 39781266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University