View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6283_low_8 (Length: 254)
Name: NF6283_low_8
Description: NF6283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6283_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 13920023 - 13919778
Alignment:
| Q |
1 |
tttttcttgttgtgatgataacaagggaggactagggttaggtatggagattgaaacatgtgagatatgcatgtagaacatgtatgataaaaggnnnnnn |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13920023 |
tttttgttgttgtgatgataacaagggaggactagggttaggtatggagattgaaacatgtgagatatgcatgtagaacatgtatgataaaaggaaaaaa |
13919924 |
T |
 |
| Q |
101 |
ngggtattgaaatttgcaacaaaagctgaaatagcaataccttgtacaccaaggtgaagtttgaaggttaagaaaatgatgatagggatgtgaatgataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919923 |
agggtattgaaatttgcaacaaaagctgaaatagcaataccttgtacaccaaggtgaagtttgaaggttaagaaaatgatgatagggatgtgaatgataa |
13919824 |
T |
 |
| Q |
201 |
cggaaagtgaagtgcaccacaataaaggccaagttgttcctttgct |
246 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13919823 |
cggaaagtgaagtgcaccacaataatggccaagttgttcctttgct |
13919778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University