View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6284_high_10 (Length: 216)
Name: NF6284_high_10
Description: NF6284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6284_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 59 - 213
Target Start/End: Original strand, 30789563 - 30789717
Alignment:
| Q |
59 |
aaaatattgtttcaacaaaagatcgtttccactttggcgaccattttctaaatcctcgagttttagtgttagctggaaattttgttttccacactatatt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
30789563 |
aaaatattgtttcaacaaaagatcgtttccactttggcgaccattttctaaatcctcgagttttagtgttaactggaaattttgttttccacactaaatt |
30789662 |
T |
|
| Q |
159 |
tactgtttggaaatttctgtttttgactctttagatataaaacttacactctctt |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789663 |
tactatttggaaatttctgtttttgactctttagatataaaacttacactctctt |
30789717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University