View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6284_high_4 (Length: 310)
Name: NF6284_high_4
Description: NF6284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6284_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 64 - 196
Target Start/End: Complemental strand, 7940887 - 7940747
Alignment:
| Q |
64 |
ctcattatctatttaagtgcaattgcttggttaatt--------aacacaaaactaatggttaacttattaaaagaaaaattaatgtcgagaaaattttg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7940887 |
ctcattatctatttaagtgcaattgcttggttaattggttaattaacacaaaactaatggttaacttattaaaagaaaaattaatgtcgagaaaattttg |
7940788 |
T |
|
| Q |
156 |
ggtgatcacgatcatttgagcatattattagttaaataata |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7940787 |
ggtgatcacgatcatttgagcatattattagttaaataata |
7940747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 294
Target Start/End: Complemental strand, 7940453 - 7940355
Alignment:
| Q |
195 |
tatatattttatgaataactaaactaaatggtatgtatttttatccnnnnnnnnntcacatgttcttaattatctcgaggtggttaatctccgcagttgc |
294 |
Q |
| |
|
||||| |||| | ||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7940453 |
tatattttttctaaataactaaactaaatggtatatatttttatccaaaaaaattt-acatgttcttaattatctcgaggtgattaatctccgcagttgc |
7940355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University