View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6285_low_6 (Length: 251)
Name: NF6285_low_6
Description: NF6285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6285_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 8443294 - 8443529
Alignment:
| Q |
14 |
aggcatgcccttaggaggaatgttttggagttannnnnnngtcttttctttgtttatcttctacgtaaagttgaataacaaattcaccaattcgtgactt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443294 |
aggcatgcccttaggaggaatgttttggagtt-tttttttgtcttttctttgtttatcttctacgtaaagttgaataacaaattcaccaattcgtgactt |
8443392 |
T |
 |
| Q |
114 |
acacgttggttgatcgcactgtttttgctcaacttacgttttctctcttttttccatagttccttcctcaaaatacttgtcgataaatgattagaaagac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8443393 |
acacgttggttgatcgcactgtttttgctcaacttacgttttctctc-tttttccatagttccttcctcaaaatacttgtcgagaaatgattagaaagac |
8443491 |
T |
 |
| Q |
214 |
cgtaatggtaccttaaataaaatggatacgatattggc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443492 |
cgtaatggtaccttaaataaaatggatacgatattggc |
8443529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University