View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6285_low_8 (Length: 237)
Name: NF6285_low_8
Description: NF6285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6285_low_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 8443870 - 8443650
Alignment:
| Q |
18 |
tttttatggaggttatgagaattatttatctagtgcgtcttcacaacttcactacgaagatttaacatcgtgccatttgataatatttaatttttcacgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443870 |
tttttatggaggttatgagaattatttatctagtgcgtcttcacaacttcactacgaagatttaacatcgtgccatttgataatatttaatttttcacgt |
8443771 |
T |
|
| Q |
118 |
gagcaataaaattcttaatgctttaaatttatcatatgatgttactatcttattctggccaaacaactaaatttgtccaataagcaaaactgtctccc-t |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
8443770 |
gagcaataaaattctttatgctttaaatttatcatatgatgttactatcttattctggccaaacaactaaatttgtccaataagctaaactgtctccctt |
8443671 |
T |
|
| Q |
217 |
tgttaggataacatatttttc |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8443670 |
tgttaggataacatatttttc |
8443650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University