View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6287_low_15 (Length: 256)
Name: NF6287_low_15
Description: NF6287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6287_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 4966873 - 4966798
Alignment:
| Q |
156 |
aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattg |
231 |
Q |
| |
|
||||||||||||||||||| || |||| |||| ||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
4966873 |
aattgcaggttgtgaaggagccatttgttgcaacttttggcaatactgcagatgatcattgtgcctatagacattg |
4966798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 9818953 - 9818870
Alignment:
| Q |
10 |
attattcttcctttcatcactgtacaatgt-tgctaatttcttctactgtataaaattcctgctgatggggttcatcttttatg |
92 |
Q |
| |
|
||||||||||||||||||||| |||||| | || || |||||||| | |||||||||| ||||||||||||| | |||||||| |
|
|
| T |
9818953 |
attattcttcctttcatcactatacaatatctgtgaacttcttctagtttataaaattcttgctgatggggttaaccttttatg |
9818870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 9818771 - 9818727
Alignment:
| Q |
156 |
aattgcaggttgtgaaggatccctttgatgcatcttttggcaata |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
9818771 |
aattgcaggttgtgaaggagccctttgatgcaacttttggtaata |
9818727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 235
Target Start/End: Original strand, 6408107 - 6408144
Alignment:
| Q |
198 |
atactgcagatgattattgtgcccatggacattggcga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6408107 |
atactgcagatgattattgtgcccatggacattggcga |
6408144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 40404534 - 40404590
Alignment:
| Q |
156 |
aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgatt |
212 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
40404534 |
aattccaggttgtgaaggaacccttagatgcaactttaggcaatactgcagatgatt |
40404590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 23202821 - 23202749
Alignment:
| Q |
156 |
aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacattg |
231 |
Q |
| |
|
||||| |||||||||| || ||||||| |||| ||||||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
23202821 |
aattgtaggttgtgaacgagccctttggtgcaacttttggcaatactgaagatg---attgtgcccatagacattg |
23202749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 9488741 - 9488797
Alignment:
| Q |
156 |
aattgcaggttgtgaaggatccctttgatgcatcttttggcaatactgcagatgatt |
212 |
Q |
| |
|
||||| ||||||||||||| ||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
9488741 |
aattgtaggttgtgaaggagccctttggtgcaacttttggcaatgttgcagatgatt |
9488797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 229
Target Start/End: Complemental strand, 7686064 - 7686005
Alignment:
| Q |
167 |
gtgaaggatccctttgatgcatcttttggcaatactgcagatgattattgtgcccatggacat |
229 |
Q |
| |
|
|||||||| ||||||| |||| ||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
7686064 |
gtgaaggagccctttggtgcaacttttggaaatactgca---gatcattgtgcccatggacat |
7686005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University