View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6287_low_17 (Length: 248)
Name: NF6287_low_17
Description: NF6287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6287_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 30 - 159
Target Start/End: Complemental strand, 7157532 - 7157403
Alignment:
| Q |
30 |
tttttatgaatttattattatcacttctattttttcttaaaagattgcacctgctttatgaacgaataatttattgnnnnnnnaaaaatgcaagataata |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7157532 |
tttttatgaatttattatcatcacttctattttttcttaaaagattgcacctgctttatgaacgaataatttattgtttttttaaaaatgcaagataata |
7157433 |
T |
|
| Q |
130 |
gttcactttaaaatctccttttatattctt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7157432 |
gttcactttaaaatctccttttatattctt |
7157403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 195 - 233
Target Start/End: Complemental strand, 7157380 - 7157342
Alignment:
| Q |
195 |
tctccttgtattattaattgtagttgttatttttgggtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7157380 |
tctccttgtattattaattgtagttgttatttttgggtc |
7157342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University