View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_high_24 (Length: 246)
Name: NF6289_high_24
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 10 - 239
Target Start/End: Original strand, 35109403 - 35109632
Alignment:
| Q |
10 |
gcataggagtattcatctattctacaccacaaattccttcaattcataagccttgcttccatatattttacttt-tgtnnnnnnnnntacaatatcatgc |
108 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||| |
|
|
| T |
35109403 |
gcataggagtatctatctattcttcaccacaaattccttcaattcataagccttgcttccgtatattttactttgtaaaaaaaaaaatacaatatcatgc |
35109502 |
T |
|
| Q |
109 |
attttactaggaaaaatgttaattgactctttaagtagtttaatattaattaattgcaatttttgacaacctgcagaaaggaataattatggaaaatcaa |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | ||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
35109503 |
attttactaggaaaattgttaattgactctttaggtagttca-tattaatgaattgcaatttttgacaacctgcagaaaggaatagttatggcaaatcaa |
35109601 |
T |
|
| Q |
209 |
acatctgagctagccattgaacaactgaaga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35109602 |
tcatctgagctagccattgaacaactgaaga |
35109632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 156 - 239
Target Start/End: Original strand, 35096174 - 35096257
Alignment:
| Q |
156 |
aattaattgcaatttttgacaacctgcagaaaggaataattatggaaaatcaaacatctgagctagccattgaacaactgaaga |
239 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35096174 |
aattaattacaatttttgacaacctgcagaaagggataactatggcaaatcaatcatctgagctagccattgaacaactgaaga |
35096257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University