View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_high_25 (Length: 243)
Name: NF6289_high_25
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 49 - 186
Target Start/End: Original strand, 5994407 - 5994545
Alignment:
| Q |
49 |
ttttttgagtaaatccctataaacaatttttggaatatttattgaaaaatataactgagtgtaatatattatttatcttttattttaaa-ttggtttgaa |
147 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
5994407 |
ttttttgagtaaattcctataaacaatttttgtaatatttattgaaaaatataactgagtgtaatatattatttatcttttattttaaatttgttttgaa |
5994506 |
T |
|
| Q |
148 |
tagggataagtagannnnnnngttcaaataaaaatatac |
186 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||| |
|
|
| T |
5994507 |
taaggataagtagatttttttgttcaaataaaaatatac |
5994545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 5994330 - 5994404
Alignment:
| Q |
1 |
ttagaatatagggataaatgtgnnnnnnngtctaaataaatatacccattttttgagtaaatccctataaacaatt |
76 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5994330 |
ttagaatatagggataaatgtgtttttt-gtctaaataaatataccaatttttttagtaaatccctataaacaatt |
5994404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University