View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_high_28 (Length: 237)
Name: NF6289_high_28
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 34154554 - 34154773
Alignment:
| Q |
1 |
ctttcaccatatacaaacaaacagacagacacat--atactgatgacggtggtttgacggaagaaactgtgtgcacagcgcaaccaaatgcgaccaatct |
98 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||| || | || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34154554 |
ctttcaccatatgcaaacaaacaaacaaacaaatagacacatatgacggtggtttgacggaagaaactgtgtgcacaacgcaaccaaatgcgaccaatct |
34154653 |
T |
 |
| Q |
99 |
aaggaaggagtgctgctattcctgtgtgtctcagtcttattgtctttgggatattttatccgtcatttacttgttgagggtctggtttaacttttactat |
198 |
Q |
| |
|
|||||||| || ||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34154654 |
----aaggagtgttgttattcttgtgtgtctgagtcttattgtctttgggatattttatctgtcatttacttgacgagggtctggtttaacttttactat |
34154749 |
T |
 |
| Q |
199 |
ggtttagacttccatgccaaaaac |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34154750 |
ggtttagacttccatgccaaaaac |
34154773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University