View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_low_16 (Length: 322)
Name: NF6289_low_16
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 16 - 281
Target Start/End: Original strand, 28735323 - 28735588
Alignment:
| Q |
16 |
gaaattgttcagtactaaaattctttatgtagagaaagtgattcattccccatcctcgcattttaactttgtctttagattttaaagatattccacgtcc |
115 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||| |||||||| || || |
|
|
| T |
28735323 |
gaaattgttaagtactaacattctttatgtagagaaagttattcgttccccatccacgcattttaactttgtctttagattttaatgatattccgcggcc |
28735422 |
T |
 |
| Q |
116 |
aggaatttacgcatcgattaagttgaagtcgggctaaatctactgcaaatacttttaatatgatgcaattttttcttatgttggagattgtattttgcag |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28735423 |
aggaatttttgcatcgattaagttgaagtcaggataaatctactgcaaatacttttcatatgatgcaattttttcttatgttggagattgtattttgcag |
28735522 |
T |
 |
| Q |
216 |
gagaaagcacacagtgatttctacttatttgataggtaaagatgcatacttaatattcccatggtt |
281 |
Q |
| |
|
|||||||||| || ||||||| || |||||||||| |||||||| ||||||||||| ||| |||| |
|
|
| T |
28735523 |
gagaaagcactcaaagatttctgctaatttgatagggaaagatgcctacttaatatttccaaggtt |
28735588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 248 - 310
Target Start/End: Original strand, 28730842 - 28730904
Alignment:
| Q |
248 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730842 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
28730904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University