View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_low_19 (Length: 299)
Name: NF6289_low_19
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 42325633 - 42325903
Alignment:
| Q |
13 |
atgaaggtagggtcttgactaaaaatagattgcttgnnnnnnnttatttggttggtaacattttaactcaacacnnnnnnnggaaatttgccggcttttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42325633 |
atgaaggtagggtcttgactaaaaatagattgcttgaaaaaaattatttggttggtaacattttaactcaacactttttttggaaatttgccggcttttc |
42325732 |
T |
 |
| Q |
113 |
tactaaagctatagggcttttatctatataagatcacttaaatcatactattggctaaaccacttttaagccaaatgtctttcgttccactccacgctgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42325733 |
tactaaagctatagggcttttatctagatgagatcacttaaatcatactattggctaaaccacttttaagccaaatgtctttcgttccactccacgctgc |
42325832 |
T |
 |
| Q |
213 |
aattacgttacattaggaggagcacgactagtgttttgtttgttgaaattttgattattaaacctaataat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42325833 |
aattacgttacattaggaggagcacgactagtgttttgtttgttgaaattttgattattaaacctaataat |
42325903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University