View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_low_20 (Length: 299)
Name: NF6289_low_20
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_low_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 17595202 - 17595485
Alignment:
| Q |
16 |
atattaaccatattgtttgctcttttttgttactttgtgttacgccctccactcaacaaaataatagtnnnnnnnncagatgaagataaatgggatgcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17595202 |
atattaaccatattgtttgctcttttttgttactttgtgttacgccctccactcaacaaaataatagtaaaaaaaacagatgaagataaatgggatgcat |
17595301 |
T |
 |
| Q |
116 |
accaattaacctatgtattagttggtgttattgcatgtgcaactgttactgaatttcttggtacacattcagttgttggagcattgatttttgggttaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17595302 |
accaattaacctatgtattagttggtgttattgcatgtgcaactgttactgaatttcttggtacacattctgttgttggagcattgatttttgggttaat |
17595401 |
T |
 |
| Q |
216 |
tcttccacgtggaaagtttacagacatgttgattgaacaaacagaagatattgcatcaggttatttggcaccattgttttttgc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595402 |
tcttccacgtggaaagtttacagacatgttgattgaacaaacagaagatattgcatcaggttatttggcaccattgttttttgc |
17595485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University