View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_low_21 (Length: 295)
Name: NF6289_low_21
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 34608281 - 34608544
Alignment:
| Q |
13 |
ttgtttttatttaaagttgtgattaa-gtacttgctcctccaaacatagcggttaatcaaatcgaatatcttacacgagcggcaaatagggaaacatgca |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34608281 |
ttgtttttatttaaagttgtgattaaagtacttgctcctccaaacatagcggttaatttaatcgaatatcttacacgagcggcaaagagggaaacatg-- |
34608378 |
T |
 |
| Q |
112 |
tgattctgtttagatactactgtatcatattgatcactattcagattcatattgagaaattaaagacatttaaaacatgatcaacactaactaaaattaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34608379 |
--attctgtttagatactactgtatcatattgatcactattcagattcatattgagaaattaaagacatttaaaacatgatcaacactaactaaaattaa |
34608476 |
T |
 |
| Q |
212 |
acgatttgtttatataatattttacattgcacatgcattattatgtgaaaatataattagcagtcatc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34608477 |
acgatttgtttatataatattttacattgcacatgcattattatgtgaaaatataattagcaggcatc |
34608544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University