View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6289_low_23 (Length: 258)
Name: NF6289_low_23
Description: NF6289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6289_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 137 - 245
Target Start/End: Complemental strand, 12153004 - 12152896
Alignment:
| Q |
137 |
tcacattctccacctttcactaagaataattctaatgtacgccaaatgttttgggttttgttttgtaggttgaacttgtgttactttgtaatccatgaga |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12153004 |
tcacattctccacctttcactaagaataattctaatgtatgccaaatgttttgggttttgttttgtaggttgaaattgtgttactttgtaatccatgaga |
12152905 |
T |
 |
| Q |
237 |
ctttctaat |
245 |
Q |
| |
|
||||||||| |
|
|
| T |
12152904 |
ctttctaat |
12152896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 85
Target Start/End: Complemental strand, 12153126 - 12153056
Alignment:
| Q |
15 |
caaaggtgtcatgggaatgttacattaaaatgaccagcgagtttggctataaagtatcttcatgatcttta |
85 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12153126 |
caaagttgtcatgggaatgttacatgaaaatgaccagcgagtttggctataaagtatcttcatgatcttta |
12153056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University