View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_high_18 (Length: 335)
Name: NF6290_high_18
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 325
Target Start/End: Original strand, 41588369 - 41588676
Alignment:
| Q |
18 |
ctttcatcgccgatcgagtaattcgcttgaaattcttcaccggcacctcaccatcacctttaccaactgcaacagcatcaccttcacctcgctgttctaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588369 |
ctttcatcgccgatcgagtaattcgcttgaaattcttcaccggcacctcaccatcacctttaccaactgcaacagcatcaccttcacctcgctgttctaa |
41588468 |
T |
|
| Q |
118 |
cacagtaaccgtttcctcaccggtttcaaccttcgattttgtggccgatctcgtaatcctcctaaacgtcggcgtcgccgtcaccggaacctcacgagac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41588469 |
cacagtaaccgtttcctcaccggtttcaaccttcgatttcgtggccgatctcgtaatcctcctaaacgtcggcgtcgccctcaccggaacctcacgagac |
41588568 |
T |
|
| Q |
218 |
tcgctcttcacatcctccttcacctcggcatcttccttgaatctcttgccatgaatttcctcggaagaagtagtagacgaattgagagacctcttagctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588569 |
tcgctcttcacatcctccttcacctcggcatcttccttgaatctcttggcatgaatttcctcggaagaagtagtagacgaattgagagacctcttagctc |
41588668 |
T |
|
| Q |
318 |
gagtataa |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
41588669 |
gagtataa |
41588676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University