View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_high_36 (Length: 240)
Name: NF6290_high_36
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 110 - 224
Target Start/End: Original strand, 52243189 - 52243306
Alignment:
| Q |
110 |
gtatccttgaagctgtctcatgtgattcctgataggacaacgaaagataggaagcgtacagaaacagaatac---aacattgtggtttccaggaaaaagc |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52243189 |
gtatccttcaagctgtctcatgtgattcctgataggacaacgaaagataggaagcgtacaaaaacagaatacaataacattgtggtttccaggaaaaagc |
52243288 |
T |
 |
| Q |
207 |
caaattataccggaaaat |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52243289 |
caaattataccggaaaat |
52243306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University