View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_high_38 (Length: 239)
Name: NF6290_high_38
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46158870 - 46158647
Alignment:
| Q |
1 |
cttaatttccaaccaaacgtttctagcacagtgaaggtttaataggtctacctaagcccaaatgccacattggtgcaaattttgttctcaatatataaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46158870 |
cttaatttccaaccaaacgtttctagcacagtgaaggtttaataggtctatctaagtccaaatgccacattggtgcaaattttgttctcaatatataaag |
46158771 |
T |
|
| Q |
101 |
ggacccacata--gagtacataaaattctgatatgtaccaaacaattgtctgccatagaacatagctattaccatctttcttatccacgaaatccctcac |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46158770 |
ggacccacatatagagtacataaaattctgatatgtaccaaacaattgtctgccatagaacatagctattaccatctttcttatccacgaaatccctcac |
46158671 |
T |
|
| Q |
199 |
gtatcctttactctatctattgtt |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46158670 |
gtatcctttactctatctattgtt |
46158647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University