View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_high_39 (Length: 232)
Name: NF6290_high_39
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 38141903 - 38142101
Alignment:
| Q |
17 |
atgaaaaaacactaggtggaatttgtgcaatgtgacacccaaaatagagtcttaatcgctggatattgtgcgaaatagcataattcacaacgcttttgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38141903 |
atgaaaaaacactaggtggaatttgtgcaatgtgacacccaacatagagtcttaatcgctggatattgtgcgaaatagcataattcacaacgcttttgat |
38142002 |
T |
 |
| Q |
117 |
tatgcgaggctgattatgtctgaaattgagagagttcagtgcgagagaggaatcacgaagagttaaaaccctatgcacgaatttgttgaatatcggtat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38142003 |
tatgcgaggctgattatgtctgaaattgagagagttcagtgcgagagaggaatcacgaagagttaaaaccctatgcacgaatttgttgaatatcggtat |
38142101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 210
Target Start/End: Original strand, 44501322 - 44501403
Alignment:
| Q |
129 |
attatgtctgaaattgagagagttcagtgcgagagaggaatcacgaagagttaaaaccctatgcacgaatttgttgaatatc |
210 |
Q |
| |
|
|||||| ||||||||||||| || |||| || ||||||||| |||||| ||||||| || ||||||||| ||||||||| |
|
|
| T |
44501322 |
attatggctgaaattgagagtgtgtagtgagatagaggaatcgtgaagagataaaaccttagacacgaatttattgaatatc |
44501403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University