View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_high_45 (Length: 206)
Name: NF6290_high_45
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 100 - 188
Target Start/End: Original strand, 13791816 - 13791904
Alignment:
| Q |
100 |
gtattagattgaattagattttccccnnnnnnnttgaactatgtctattgagatttcgatatcaaactcttgcgcttaatatgacacct |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13791816 |
gtattagattgaattagattttccccaaaaaaattgaactatgtctattgagatttcgatatcaaactcttgcgcttaatatgacacct |
13791904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University