View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6290_high_45 (Length: 206)

Name: NF6290_high_45
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6290_high_45
NF6290_high_45
[»] chr2 (1 HSPs)
chr2 (100-188)||(13791816-13791904)


Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 100 - 188
Target Start/End: Original strand, 13791816 - 13791904
Alignment:
100 gtattagattgaattagattttccccnnnnnnnttgaactatgtctattgagatttcgatatcaaactcttgcgcttaatatgacacct 188  Q
    ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13791816 gtattagattgaattagattttccccaaaaaaattgaactatgtctattgagatttcgatatcaaactcttgcgcttaatatgacacct 13791904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University