View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_12 (Length: 374)
Name: NF6290_low_12
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 359
Target Start/End: Complemental strand, 38196722 - 38196380
Alignment:
| Q |
18 |
gaacagaacactttagagtggctgatttgatggaacagaacaggcaaggatggaattggggattgatagatggtatgttcaatgaaagagacaaagggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196722 |
gaacagaacactttagagtggctgatttgatggaacagaacaggcaaggatggaattggggattgatagatggtatgttcaatgaaagagacaaagggga |
38196623 |
T |
 |
| Q |
118 |
gatttgcaagctcacaatcacaatggctacagaggaagacaagcttatttggaaatttaataatagaggtaattatactgtgaaatcagcatatcgatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196622 |
gatttgcaagctcacaatcacaatggctacagaggaagacaagcttatttggaaatttaataatagaggtaattatactgtgaaatcagcatatcgatat |
38196523 |
T |
 |
| Q |
218 |
gctatagagactctaattgataatgaagagtaccgagtaccaggggagtgggagaaaatgtggaagcttagatttccgcaacgggtaaaagtgtttcttt |
317 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38196522 |
gctatggagactctaattgataatgaagagtaccgagtaccaggggagtgggagaaaatgtggaagcttagatttccgcagcgggtaaaagtgtttcttt |
38196423 |
T |
 |
| Q |
318 |
ggagtgcacagattgcagtccacatt-tgagaacaattacgag |
359 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
38196422 |
ggagtgcacagattgctgtccacattgtgagaacaattacgag |
38196380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University