View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_16 (Length: 347)
Name: NF6290_low_16
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 90 - 318
Target Start/End: Complemental strand, 5260941 - 5260712
Alignment:
| Q |
90 |
aaaatatatttgcaaatatttatatggtgatatgtgtataattaattgattgaattaattgtaannnnnnnnacacggattatgaattaatacaaattat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5260941 |
aaaatatatttgcaaatatttatatggttatatgtgtatgattaattgattgaattaattgtaattttttt-acacggattatgaattaatacaaattat |
5260843 |
T |
|
| Q |
190 |
atcaaaataatattttgaaatcgttgttttctgtgtcctgtatctcttcc--atatcaattttctaccctcagataattttcattttgctctaaaatgta |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5260842 |
atcaaaataatattttgaaatcgttgttttctgtgtcctgtatctcttccatatatcaattttctaccctcagataattttcattttgctctaaaatgta |
5260743 |
T |
|
| Q |
288 |
taacttaaaagtcaatgaaagttgtcatagg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5260742 |
taacttaaaagtcaatgaaagttgtcatagg |
5260712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University