View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_18 (Length: 345)
Name: NF6290_low_18
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 52584954 - 52584618
Alignment:
| Q |
1 |
tagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaatagtttcttcagtacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584954 |
tagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaatagtttcttcagtacgt |
52584855 |
T |
 |
| Q |
101 |
aaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctctttttccataaaaatctctcttctttcactgttctagagagatccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584854 |
aaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctccttttccataaaaatctctcttctttcactgttctagagagatccac |
52584755 |
T |
 |
| Q |
201 |
atcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttattttttcaatcactttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52584754 |
atcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttatttattcaatcactttc |
52584655 |
T |
 |
| Q |
301 |
tctcagacnnnnnnngctagctacaattgatgatgtc |
337 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |
|
|
| T |
52584654 |
tctcagacaaaaaaagctagctacaattaatgatgtc |
52584618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University