View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_25 (Length: 290)
Name: NF6290_low_25
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 23 - 274
Target Start/End: Complemental strand, 6967502 - 6967250
Alignment:
| Q |
23 |
atgagatgttgatagttgatcttgattcttgaatcagaattgcatgtctttttcatagtacactgtttcagaaacaggttggacttttgaccacatgcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6967502 |
atgagatgttgatagttgatcttgattcttgaatcagacttgcatgtctttttcatagtacactgttccagaaacaggttggacttttgaccacatgcaa |
6967403 |
T |
|
| Q |
123 |
aagacaacatagccacagttgcttgcttgtcacactacttgtattgtcatgtaatgtggtgaccatgagtttagttaagtttgtagaattcatttaaact |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6967402 |
aagacaacatagccacagttgcttgcttgtcacactacttgtattgtcatgtaatgtggtgaccatgagtttagttaagtttgtagaattcatttaaact |
6967303 |
T |
|
| Q |
223 |
gaattagaacaaattaatgactattt-cataaattatagtgcccaaatctgtg |
274 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6967302 |
gatttagaacaaattaatgactatttccataaattatagtgcccaaatctgtg |
6967250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University