View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_29 (Length: 275)
Name: NF6290_low_29
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 12 - 275
Target Start/End: Complemental strand, 36541850 - 36541587
Alignment:
| Q |
12 |
agagagtggagaatatcaattcattaagaaaggttttttaaaaggtatgggatttatggtggatgttacaaatataatggccattcacaagaacaacgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36541850 |
agagagtggagaatatcaattcattaagaaaggttttttaaagggtatgggatttatggtggatgttacaaatatcatggccattcacaagaacaacgtt |
36541751 |
T |
 |
| Q |
112 |
tcctctaatttgacaaagcaagctagtttggattcatttcacattttctctaaggcggtgtcaatcaaatgtggaggtaatgctaatgttaggtgtgctt |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541750 |
tccactaatttgacaaagcaagctagtttggattcatttcacattttctctaaggcggtgtcaatcaaatgtggaggtaatgctaatgttaggtgtgctt |
36541651 |
T |
 |
| Q |
212 |
ggtatggtggctcattagatgaactcgtagatattgtatgttttggattcaccggatgcaatat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36541650 |
ggtatggtggctcattagatgaactcgtagatattgtatcttttggattcaccggatgcaatat |
36541587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University