View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_35 (Length: 253)
Name: NF6290_low_35
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 30877128 - 30877364
Alignment:
| Q |
1 |
caaaaatgctaccat-aacacttaatttcaatctctcaatgtttggggtttatttgttctttttgacctacacccaccgttggataaagtcttatatttt |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877128 |
caaaaatgctaccatcaacacttaatttcagtctctcaatgcttggggtttatttgttctttttgacctacacccaccgttggataaagtcttatatttt |
30877227 |
T |
|
| Q |
100 |
acatgtatnnnnnnnnnnnntccaatgaaatagtattctttatccttttgattaaatcattggtttatacttctttcattttatgatcggaaaatatttc |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877228 |
acatgtataaaaaataaaaatccaatgaaatagtattctttatccttttgattaagtcattggtttatacttctttcattttatgatcggaaaatatttc |
30877327 |
T |
|
| Q |
200 |
atggacccgtacatccaactaacatcatgcgagagaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877328 |
atggacccgtacatccaactaacatcatgcgagagaa |
30877364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University