View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6290_low_43 (Length: 229)
Name: NF6290_low_43
Description: NF6290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6290_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 27601038 - 27600838
Alignment:
| Q |
8 |
gagtgagaagaagaaaatgtggctaaactacaaaatgccagcaactgaactattgatgttgaatttttcaatagcaaactcttcagaatgtcatggcaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27601038 |
gagtaagaagaagaaaatgtggctaaactacaaaatgccagcaactgaactattgatgttgaatttttcaatagcaaacttttcagaatgtcatggcaat |
27600939 |
T |
 |
| Q |
108 |
ttagcttctgttgaagaaacattatattttatataacaatataaaacattttgtattggttggtcagtcaagaagattaaagttagaaggagaaacccaa |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27600938 |
ttagcttctgtggaagaaacattatattttatataacaatatacaacattttgtattggttg----gtcaagaagattaaagttagaaggagaaacccaa |
27600843 |
T |
 |
| Q |
208 |
ataga |
212 |
Q |
| |
|
||||| |
|
|
| T |
27600842 |
ataga |
27600838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University