View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6291_high_17 (Length: 262)
Name: NF6291_high_17
Description: NF6291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6291_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 35163321 - 35163077
Alignment:
| Q |
1 |
atttccttcattttggaggttatatttaatatttaatgtttcaatcatcaatcaaccggtagttaagtgaattatttggcggttgttctttgtttaccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163321 |
atttccttcattttggaggttatatttaatatttaatgtttcaatca---atcaactggtagttaagtgaattatttggcggttgttctttgtttacc-- |
35163227 |
T |
 |
| Q |
101 |
ctgtgaagtgggattgaaattattttagaagagacaaagtaggagttgataaattagtttttcctgttttatttagatttagagacacaaggtttaaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163226 |
-tgtgaagtgggattgaaattattttagaagagacaaagtaggagttgataaattagtttttcctgttttatttagatttagagacacaaggtttaaata |
35163128 |
T |
 |
| Q |
201 |
atttggcttggtaaagaatttgtcacatgttaaatatgagtaatgagtataatcta |
256 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35163127 |
at-----taggtaaagaatttgtcacatgttaaatatgagtgatgagtataatcta |
35163077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University