View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6291_high_21 (Length: 240)
Name: NF6291_high_21
Description: NF6291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6291_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 123 - 222
Target Start/End: Complemental strand, 28956215 - 28956116
Alignment:
| Q |
123 |
tgaactttgaaaaattgcacctacaatcttatgttttcttgttttgaaccccctgaaaaattagtgttgcaccttgagtttctctctcacacacactgtc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28956215 |
tgaactttgaaaaattgcacctacaatcttatgttttcttgttttgaaccccctgaaaaattagtattgcaccttgagtttctctctcacacacactgtc |
28956116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 6941393 - 6941321
Alignment:
| Q |
6 |
attgcaaggcatatgcaaaaatgataaatgagcaagaattgtatgatcgtatggattttgagatcacacaatc |
78 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6941393 |
attgcaaagcatatgcaaaaacgataaatgagcaagaattgtatgatggtatggattttgagatcacacaatc |
6941321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 79 - 222
Target Start/End: Original strand, 39620119 - 39620260
Alignment:
| Q |
79 |
agggccggagccagccctagttgagggtgtgcacgtgcacaccctgaactttgaaaaattgcacctacaatcttatgttttcttgttttgaaccccctga |
178 |
Q |
| |
|
|||| |||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| || |
|
|
| T |
39620119 |
aggggcggagccaaccctagttgagggtatgcacctgcacaccctgaactttgaaaaattgcatctacaatcttatgttttcttgttttgaatcccgtgg |
39620218 |
T |
 |
| Q |
179 |
aaaattagtgttgcaccttgagtttctctctcacacacactgtc |
222 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
39620219 |
aaaattagaattgcaccttgag--tctctcacacacacactgtc |
39620260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 137 - 222
Target Start/End: Original strand, 12804926 - 12805011
Alignment:
| Q |
137 |
ttgcacctacaatcttatgttttcttgttttgaaccccctgaaaaattagtgttgcaccttgagtttctctctcacacacactgtc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804926 |
ttgcacctacaatcttatgttttcttgttttgaacctcctgaaaaattagtgttgcaccttgagtttctctctcacacacactgtc |
12805011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 12804853 - 12804926
Alignment:
| Q |
23 |
aaaatgataaatgagcaagaattgtatgatcgtatggattttgagatcacacaatcagggccggagccagccct |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12804853 |
aaaatgataaatgagcaagaattgtatgatcgtatggattttgagatcacacaatcaggggcggagccagccct |
12804926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 12806224 - 12806302
Alignment:
| Q |
1 |
atattattgcaaggcatatgcaaaaatgataaatgagcaagaattgtatgatcgtatggattttgagatcacacaatca |
79 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12806224 |
atattattgcaaaacatatggaaaaacgataaatgagctagaattgtatgatcgtacggattttgagatcacacaatca |
12806302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 73
Target Start/End: Complemental strand, 18887490 - 18887424
Alignment:
| Q |
6 |
attgcaaggcatatgcaaaaatgataaatgagcaagaattgtatgatcgtatggattttgagatcaca |
73 |
Q |
| |
|
||||||| || ||| |||||| ||||| ||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
18887490 |
attgcaaagcgtatacaaaaacgataa-tgagctagaattttatgatcatatggattttgagatcaca |
18887424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 142
Target Start/End: Original strand, 28883938 - 28883975
Alignment:
| Q |
105 |
gtgtgcacgtgcacaccctgaactttgaaaaattgcac |
142 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
28883938 |
gtgtgcacgtgcataccctaaactttgaaaaattgcac |
28883975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 100 - 138
Target Start/End: Complemental strand, 8456687 - 8456649
Alignment:
| Q |
100 |
tgagggtgtgcacgtgcacaccctgaactttgaaaaatt |
138 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8456687 |
tgagggtgtgcacctgcacaccctgaactttgaaaaatt |
8456649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 136
Target Start/End: Original strand, 14705654 - 14705717
Alignment:
| Q |
73 |
acaatcagggccggagccagccctagttgagggtgtgcacgtgcacaccctgaactttgaaaaa |
136 |
Q |
| |
|
|||| ||||| |||| ||||||||| ||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
14705654 |
acaaccaggggcggatccagccctatgtgagggtgtgcacttgcacaccctgaattttcaaaaa |
14705717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 136
Target Start/End: Original strand, 32799084 - 32799116
Alignment:
| Q |
104 |
ggtgtgcacgtgcacaccctgaactttgaaaaa |
136 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
32799084 |
ggtgtgcacctgcacaccctgaactttgaaaaa |
32799116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University