View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6291_low_19 (Length: 251)
Name: NF6291_low_19
Description: NF6291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6291_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 27762032 - 27761791
Alignment:
| Q |
1 |
tgtgcatgagtttgatttcgtgtgctatggttaaaattcctt-actattgtgatagtcgaaggcacctgattttaaactcattgtgccgctagcccagac |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27762032 |
tgtgcatgggtttgatttcgtgtgctatggttaaaattcctttactattgtgatagtcgaagccacctgattttaaactcattgtgccgctagcccagac |
27761933 |
T |
|
| Q |
100 |
caaacataaatcatcataatttaaaaattagaaatcgtaaaacctacatccgagagagaacatttttcatttacctgtagtgttccacaacttggtaagc |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27761932 |
caaacataaatcgtcataatttaaaaattagaaatcataaaacctacatccaagagagaacctttttcatttaccagtagtgttccacaacttggtaagc |
27761833 |
T |
|
| Q |
200 |
ttctgaagcaaatcctttgatatgtatgacttatcccctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27761832 |
ttctgaagcaaatcctttgatatgtatgacttatcccctttg |
27761791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University