View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6292_low_3 (Length: 206)
Name: NF6292_low_3
Description: NF6292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6292_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 33235700 - 33235903
Alignment:
| Q |
1 |
tcatttattggaaattaatttgaaatttgaacaggagctaagaaagtggacgtggacttgaagcagcagaaagtgaccgtgattggatatgttgaaccaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
33235700 |
tcatttattggaaattaatt-gaaatttgaacaggagctaagaaagtggatgtggacttgaagcagcagaaagtaacggtgagtggatatgttgaaccaa |
33235798 |
T |
|
| Q |
101 |
agaaagtgttgaaagctgctcaatctacaaagaagaaggttgagctttggccttatgttccatacactatggtggctcatccttatatttcacaagccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33235799 |
agaaagtgttgaaagctgctcaatctacaaagaagaaggttgagctttggccttatgttccatacactatggtggctcatccttatatttcacaagccta |
33235898 |
T |
|
| Q |
201 |
tgata |
205 |
Q |
| |
|
||||| |
|
|
| T |
33235899 |
tgata |
33235903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University