View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6293_high_13 (Length: 229)

Name: NF6293_high_13
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6293_high_13
NF6293_high_13
[»] chr3 (1 HSPs)
chr3 (184-229)||(29394378-29394423)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 29394378 - 29394423
Alignment:
184 tatctatagtttgatagtattatgaatgcgcatccgaaagttgttt 229  Q
    |||||||||||||||||||||||||||| |||||||||||||||||    
29394378 tatctatagtttgatagtattatgaatgtgcatccgaaagttgttt 29394423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University