View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6293_high_9 (Length: 242)
Name: NF6293_high_9
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6293_high_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 29394696 - 29394474
Alignment:
| Q |
19 |
ggggtggggtggatcatattattattctttagcaaagacataaacacagatctctacacatcttgtgatcataccttattcaatttggaaggtgtgtctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394696 |
ggggtggggtggatcatattattattctttagcaaagacataaacacagatctctacacatcttgtgatcataccttattcaatttggaaggtgtgtctt |
29394597 |
T |
|
| Q |
119 |
agttaatgattttgtaatttcatttatgtcaatggccatgtgtcgtatgattgtgtccctttcttcacagcttgctaccctactttattccggtcaaaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29394596 |
agttaatgattttgtaatttcatttatgtgaatggccatgtgtcgtatgattgtgtccctttcttcacagcttgctacccta-tttattccggtcaaaat |
29394498 |
T |
|
| Q |
219 |
tacatcggcgatcctttaaatttg |
242 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
29394497 |
tacatcggcggtcctttaaatttg |
29394474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University