View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6293_low_13 (Length: 235)

Name: NF6293_low_13
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6293_low_13
NF6293_low_13
[»] chr4 (1 HSPs)
chr4 (19-208)||(36552412-36552607)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 36552607 - 36552412
Alignment:
19 cataaaaactgttttagtgtgtttaagcttcatagtgaaagagagtgtgtaaattaacatttgatggctagtatcaaacaaatagaaa------agaaga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||    
36552607 cataaaaactgttttagtgtgtttaagcttcatagtgaaagagagtgtgtaaattaacatttgatggctagtatcaaacaaatagaaatagaaaagaaga 36552508  T
113 aggcatgtgtgataggtggcactggttttgtggcatcattgctgatcaagcagttgcttgaaaagggttatgctgttaatactactgttagagacc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36552507 aggcatgtgtgataggtggcactggttttgtggcatcattgctgatcaagcagttgcttgaaaagggttatgctgttaatactactgttagagacc 36552412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University