View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6293_low_13 (Length: 235)
Name: NF6293_low_13
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6293_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 36552607 - 36552412
Alignment:
| Q |
19 |
cataaaaactgttttagtgtgtttaagcttcatagtgaaagagagtgtgtaaattaacatttgatggctagtatcaaacaaatagaaa------agaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36552607 |
cataaaaactgttttagtgtgtttaagcttcatagtgaaagagagtgtgtaaattaacatttgatggctagtatcaaacaaatagaaatagaaaagaaga |
36552508 |
T |
 |
| Q |
113 |
aggcatgtgtgataggtggcactggttttgtggcatcattgctgatcaagcagttgcttgaaaagggttatgctgttaatactactgttagagacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36552507 |
aggcatgtgtgataggtggcactggttttgtggcatcattgctgatcaagcagttgcttgaaaagggttatgctgttaatactactgttagagacc |
36552412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University