View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6293_low_17 (Length: 212)
Name: NF6293_low_17
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6293_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 47 - 198
Target Start/End: Original strand, 38038530 - 38038681
Alignment:
| Q |
47 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgttgtttgaggaagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038530 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttgagggagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
38038629 |
T |
 |
| Q |
147 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaact |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038630 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaact |
38038681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University