View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6293_low_4 (Length: 400)
Name: NF6293_low_4
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6293_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 58 - 390
Target Start/End: Original strand, 38038680 - 38039013
Alignment:
| Q |
58 |
cttaattagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatgattttactagcttattgggt |
157 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38038680 |
cttaactagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatcattttactagcttattgggt |
38038779 |
T |
|
| Q |
158 |
attatggtataaggtaccacttttttgatgtacaatataaaagag-aaatacagtaaaaagagactgactatgattaagcaattctgaaaactggggttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38038780 |
attatggtataaggtaccacttttttgatgtacaatataaaagaggaaatacagtaaaaagagactaactatgattaagcaattctgaaaactggggttt |
38038879 |
T |
|
| Q |
257 |
atatcttgttgtagattcaccaatttttcttgcttatacaagcttaagcatatagtataaatgaatcatcatctaacggaactgctagtccttaagccaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038880 |
atatcttgttgtagattcaccaatttttcttgcttatacaagcttaagcatatagtataaatgaatcatcatctaacggaactgctagtccttaagccaa |
38038979 |
T |
|
| Q |
357 |
ttctttgtatttgaggtgatgacaccacaggttc |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38038980 |
ttctttgtatttgaggtgatgacaccacaggttc |
38039013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 38025340 - 38025404
Alignment:
| Q |
120 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
184 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38025340 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38025404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 38030739 - 38030803
Alignment:
| Q |
120 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
184 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38030739 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38030803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University