View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6293_low_8 (Length: 269)
Name: NF6293_low_8
Description: NF6293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6293_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 37045889 - 37045776
Alignment:
| Q |
16 |
gatgaatgcggcagtcggtctctgtttaattac---aatctgcatgccatcatgcattagactcactgtaccactttcgtacctacgtgtctacctctca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37045889 |
gatgaatgcggcagtcggtctctgtttaattactacaatctgcatgccatcatgcattagactcactgtaccactttcggacctacgtgtctacctctca |
37045790 |
T |
|
| Q |
113 |
taataaattctgga |
126 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37045789 |
taataaattctgga |
37045776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 153 - 251
Target Start/End: Complemental strand, 37045788 - 37045689
Alignment:
| Q |
153 |
aataaattctggatcttttctcataataaagcagaactgcgcaaatcctcaccattaagtattcatttatatttcttcttctaaatgaat-caccatgca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37045788 |
aataaattctggatcttttctcataataaagcagaactgcgcaaatcctcaccattaagtattcatttatatttcttcttctaaatgaatccaccatgca |
37045689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University