View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6294_low_17 (Length: 308)

Name: NF6294_low_17
Description: NF6294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6294_low_17
NF6294_low_17
[»] chr1 (1 HSPs)
chr1 (1-290)||(51010454-51010743)


Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 51010454 - 51010743
Alignment:
1 gaacatgataacaaaagcttgatgacagaaaataatcaatatatgtttgtggatcctttagacacaaaaaagaagcaagaaaatgttgttggcagatcag 100  Q
    |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51010454 gaacatgatagcaaaagcttgatgacagaaaataatcaatatgtgtttgtggatcctttagacacaaaaaagaagcaagaaaatgttgttggcagatcag 51010553  T
101 attcaatgtcagattgcagtgatcaaaatgaagaagaggatgatggaaaatataggagaagaagtggaaaaggaaaccaatcaaagaaccttgttgctga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51010554 attcaatgtcagattgcagtgatcaaaatgaagaagaggatgatggaaaatataggagaagaagtggaaaaggaaaccaatcaaagaaccttgttgctga 51010653  T
201 gagaaaaagaaggaagaaactgaatgataggttatataaccttcgttcattggttccaagaatctcaaagcttgatagagcttctattct 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51010654 gagaaaaagaaggaagaaactgaatgataggttatataaccttcgttcattggttccaagaatctcaaagcttgatagagcttctattct 51010743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University