View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6294_low_22 (Length: 263)
Name: NF6294_low_22
Description: NF6294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6294_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 42800508 - 42800750
Alignment:
| Q |
11 |
attcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttagcaggcaaaggaaaagcagaaacaggtatgctttcaaaacaagca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800508 |
attcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttagcaggcaaaggaaaagcagaaacaggtatgctttcaaaacaagca |
42800607 |
T |
 |
| Q |
111 |
ttaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaactctcctcccaagtttggcttcagggctccttggcatctctctca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800608 |
ttaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaactctcatcccaagtttggcttcagggctccttggcatctctctca |
42800707 |
T |
 |
| Q |
211 |
ttgtagccattgccattattccctcttcttttctctctctgtg |
253 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42800708 |
ttgtagccattgccattactccctcttcttttctctctctgtg |
42800750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University